stardust revolution the new story of our origin in the stars

Download Book Stardust Revolution The New Story Of Our Origin In The Stars in PDF format. You can Read Online Stardust Revolution The New Story Of Our Origin In The Stars here in PDF, EPUB, Mobi or Docx formats.

The Stardust Revolution

Author : Jacob Berkowitz
ISBN : 9781616145507
Genre : Science
File Size : 33. 98 MB
Format : PDF, ePub
Download : 251
Read : 640

Download Now Read Online


Three great scientific revolutions have shaped our understanding of the cosmos and our relationship to it. The sixteenth and seventeenth centuries witnessed the Copernican Revolution, which bodychecked the Earth as the pivot point of creation and joined us with the rest of the cosmos as one planet among many orbiting the Sun. Three centuries later came the second great scientific revolution: the Darwinian Revolution. It removed us from a distinct, divine biological status to place us wholly in the ebb and flow of all terrestrial life. This book describes how we’re in the midst of a third great scientific revolution, five centuries in the making: the Stardust Revolution. It is the merging of the once-disparate realms of astronomy and evolutionary biology, and of the Copernican and Darwinian Revolutions, placing life in a cosmic context. The Stardust Revolution takes readers on a grand journey that begins on the summit of California’s Mount Wilson, where astronomers first realized that the universe is both expanding and evolving, to a radio telescope used to identify how organic molecules—the building blocks of life—are made by stars. It’s an epic story told through a scientific cast that includes some of the twentieth century’s greatest minds—including Nobel laureate Charles Townes, who discovered cosmic water—as well as the most ambitious scientific explorers of the twenty-first century, those racing to find another living planet. Today, an entirely new breed of scientists—astrobiologists and astrochemists—are taking the study of life into the space age. Astrobiologists study the origins, evolution, and distribution of life, not just on Earth, but in the universe. Stardust science is filling in the missing links in our evolutionary story, ones that extend our family tree back to the stars. From the Hardcover edition.

The Magic Furnace

Author : Marcus Chown
ISBN : 9781448112746
Genre : Science
File Size : 81. 27 MB
Format : PDF, ePub, Mobi
Download : 869
Read : 781

Download Now Read Online


Every atom in our bodies has an extraordinary history. Our blood, our food, our books, our clothes - everything contains atoms forged in blistering furnaces deep inside stars, which were blown into space by those stars' cataclysmic explosions and deaths. From red giants - stars so enormous they could engulf a million suns - to supernova explosions - the most violent events in the universe - the birth of every atom was marked by cosmic events on an enormous scale, against a backdrop of unimaginable heat and cold, brightness and darkness, space and time. But how did we discover the astonishing truth about our cosmic origins? THE MAGIC FURNACE is Marcus Chown's extraordinary account of how scientists unravelled the mystery of atoms, and helped to explain the dawn of life. It is one of the greatest detective stories in the history of science. In fact, it is two puzzles intertwined, for the stars contain the key to unlocking the secret of atoms, and the atoms the solution to the secret of stars.

The Story Of Earth

Author : Robert M. Hazen
ISBN : 9781101580684
Genre : Science
File Size : 70. 38 MB
Format : PDF, Mobi
Download : 204
Read : 564

Download Now Read Online


Hailed by The New York Times for writing “with wonderful clarity about science . . . that effortlessly teaches as it zips along,” nationally bestselling author Robert M. Hazen offers a radical new approach to Earth history in this intertwined tale of the planet’s living and nonliving spheres. With an astrobiologist’s imagination, a historian’s perspective, and a naturalist’s eye, Hazen calls upon twenty-first-century discoveries that have revolutionized geology and enabled scientists to envision Earth’s many iterations in vivid detail—from the mile-high lava tides of its infancy to the early organisms responsible for more than two-thirds of the mineral varieties beneath our feet. Lucid, controversial, and on the cutting edge of its field, The Story of Earth is popular science of the highest order.

The View From The Center Of The Universe

Author : Joel R. Primack
ISBN : 9781101126882
Genre : Science
File Size : 33. 72 MB
Format : PDF
Download : 374
Read : 308

Download Now Read Online


In this strikingly original book, a world-renowned cosmologist and an innovative writer of the history and philosophy of science uncover an astonishing truth: Humans actually are central to the universe. What does this mean for our culture and our personal lives? The answer is revolutionary: a science-based cosmology that allows us to understand the universe as a whole and our extraordinary place in it.

They Were Soldiers

Author : Ann Jones
ISBN : 9781608463879
Genre : History
File Size : 71. 49 MB
Format : PDF, Mobi
Download : 632
Read : 838

Download Now Read Online


A reporter’s firsthand, close-up-and-personal look at the impact of our recent wars on America’s unlucky soldiers.

Creation

Author : Adam Rutherford
ISBN : 9780141970226
Genre : Science
File Size : 40. 1 MB
Format : PDF, ePub, Mobi
Download : 884
Read : 197

Download Now Read Online


'You will not find a better, more balanced or up-to-date take on either the origin of life or synthetic biology. Essential reading' Observer Creation by Adam Rutherford tells the entire spellbinding story of life in two gripping narratives. 'Prepare to be astounded. There are moments when this book is so gripping it reads like a thriller' Mail on Sunday The Origin of Life is a four-billion-year detective story that uses the latest science to explain what life is and where it first came from, dealing with life's biggest questions and arriving at a thrilling answer. 'A superbly written explanation' Brian Cox The Future of Life introduces an extraordinary technological revolution: 'synthetic biology', the ability to create entirely new life forms within the lab. Adam Rutherford explains how this remarkable innovation works and presents a powerful argument for its benefit to humankind. 'The reader's sense of awe at the well-nigh inconceivable nature of nature is suitably awakened. The extraordinary science and Rutherford's argument are worth every reader's scrutiny. Fascinating' Sunday Telegraph 'One of the most eloquent and genuinely thoughtful books on science over the past decade. You will not find a better, more balanced or up-to-date take on the origin of life or synthetic biology. Essential reading for anyone interested in the coming revolution, which could indeed rival the Industrial Revolution or the internet' Observer 'The perfect primer on the past and future of DNA' Guardian 'Susenseful, erudite and thrilling' Prospect 'A witty, engaging and eye-opening explanation of the basic units of life, right back to our common ancestors and on to their incredible synthetic future. The mark of a really good science book, it shows that the questions we still have are just as exciting as the answers we already know' Dara O Briain 'This is a quite delightful two-books-in-one. Rutherford's lightness of touch in describing the dizzying complexity of life at the cellular level in The Origin of Life only serves to emphasise the sheer scale and ambition of the emerging field of synthetic biology' Jim Al Khalili 'A fascinating glimpse into our past and future. Rutherford's illuminating book is full of optimism about what we might be able to achieve' Sunday Times 'Fresh, original and excellent. An eye-opening look at how we are modifying and constructing life. Totally fascinating' PopularScience.co.uk 'In this book of two halves, Rutherford tells the epic history of life on earth, and eloquently argues the case for embracing technology which allows us to become biological designers' Alice Roberts 'An engaging account of both the mystery of life's origin and its impending resolution as well as a fascinating glimpse of the impending birth of a new, synthetic biology'' Matt Ridley, author of Genome 'I warmly recommend Creation. Rutherford's academic background in genetics gives him a firm grasp of the intricacies of biochemistry - and he translates these superbly into clear English' Financial Times Dr Adam Rutherford is a geneticist, writer and broadcaster. He presents BBC Radio 4's weekly programme Inside Science and his documentaries include the award-winning series The Cell (BBC4), The Gene Code (BBC4), Horizon: 'Playing God' (BBC2) as well as numerous other programmes for BBC Radio 4. This is his first book. TGTCGTGAAGCTACTATTTAAAATGCCACAGTGAAAGATTAAACGCCCGAAAACGGGGTGATAAATGGACGGTAAGTTCCCGACTAAACGTGTTAAATG

Life S Ratchet

Author : Peter M. Hoffmann
ISBN : 9780465022533
Genre : Science
File Size : 30. 41 MB
Format : PDF, Kindle
Download : 284
Read : 153

Download Now Read Online


A physicist describes how life emerges from the random motion of atoms through sophisticated cellular machinery and describes the long quest to determine the true nature of life from ancient Greece to the study of modern nanotechnology. 20,000 first printing.

Top Download:

New Books